Highly efficient in vitro transcription. Empty backbone.</br>This plasmid is intended to be used as a platform for in vitro transcription. GOI can be cloned at EcoRV site in blunt. Template for IVT is obtained by PCR with forward primer consisting on a primer that contains the T7 promoter sequence and part of the 5’UTR (5’ TTGGACCCTCGTACAGAAGCTAATACGACTCACTATAGGGAAATAAGAGAGAAAAGAAGAG 3’) and a 55 polyT (or longer) as reverse primer. No need for polyA polimerase treatment after IVT. Resulting mRNA will contain 5’UTR-GOI-3’UTR-pA (55bp or longer) and it is ready to be transfected.

UTRs are from X. laevis and β-globin gene and can be used for H. sapiens and M. musculus.